Ecological Archives M078-007-A3

Ivan Gomez-Mestre, John J. Wiens, and Karen M. Warkentin. 2008. Evolution of adaptive plasticity: risk-sensitive hatching in Neotropical leaf-breeding treefrogs. Ecological Monographs 78:205–224.

Appendix C. A list of primers used in the study for polymerase chain reaction amplification and sequencing of three mitochondrial and four nuclear loci. F = forward primer; R = reverse primer.

Primer

Sequence (5'-3')

Source

 

Mitochondrial

12S

 

 

t-Phe-frog (F)

ATAGCRCTGAARAYGCTRAGATG

Wiens et al. (2005)

t-Val-frog (R)

TGTAAGCGARAGGCTTTKGTTAAGCT

Wiens et al. (2005)

 

cyt-b

 

 

CBJ10933 (F)

TATGTTCTACCATGAGGACAAATATC

Bossuyt and Milinkovitch (2000)

CytbC (R)

CTACTGGTTGTCCTCCGATTCATGT

Bossuyt and Milinkovitch (2000)

 

ND1

 

 

ND1-F5 (R)

TTACGACCTCGATGTTGGATCAG

this study

ND1-R3 (R)

GATTAGAGCTAGTGTGACTTC

Wiens et al. (2005)

 

Nuclear

c-myc, exon 2

 

 

c-myc 1U (F)

GAGGACATCTGGAARAARTT

Crawford (2003)

c-myc F2 (R)

ACMGAGTTCCTGGGAGGGGACATGG

Smith et al. (2005)

 

POMC

 

 

POMC-1 (F)

GAATGTATYAAAGMMTGCAAGATGGWCCT

Wiens et al. (2005)

POMC-2 (R)

TAYTGRCCCTTYTTGTGGGCRTT

Wiens et al. (2005)

 

RAG-1

 

 

RS1f (F)

TGCAGTCAGTAYCAYAARATGTAC

P. Chippindale (personal communication)

R1-GFr (R)

GAAGCGCCTGAACAGTTTATTAC

Faivovich et al. (2005)

 

TNS3

 

 

WL421 (R)

CAGTGTTGGAGAAGATGGTATGTC

this study

WL423 (F)

CAGCATAGGTACTTTATCATCATCAG

this study

LITERATURE CITED

Bossuyt, F., and M. C. Milinkovitch. 2000. Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proceedings of the National Academy of Sciences of the United States of America 97:6585–6590.

Crawford, A. J. 2003. Huge populations and old species of Costa Rican and Panamanian dirt frogs inferred from mitochondrial and nuclear gene sequences. Molecular Ecology 12:2525–2540.

Faivovich, J., C. F. B. Haddad, P. C. A. Garcia, D. R. Frost, J. A. Campbell, and W. C. Wheeler. 2005. Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. Bulletin of the American Museum of Natural History 294:1–240.

Smith, S. A., P. R. Stephens, and J. J. Wiens. 2005. Replicate patterns of species richness, historical biogeography, and phylogeny in Holarctic treefrogs. Evolution 59:2433–2450.

Wiens, J. J., J. W. Fetzner, C. L. Parkinson, and T. W. Reeder. 2005. Hylid frog phylogeny and sampling strategies for speciose clades. Systematic Biology 54:719–748.


[Back to M078-007]